Posted by on 12 lipca 2018

Jako referencję wykorzystano męski DNA oczyszczony z próbek krwi pobranych od mężczyzn i dostarczonych przez Promega. W celu wykreślenia delecji chromosomu X zastosowano docelową mikromacierz o wysokiej rozdzielczości X-chromosom zaprojektowany w Pittsburgh Cytogenetics Laboratory (180K oligonukleotyd aCGH z użyciem platformy Agilent). Dane aCGH analizowano przy użyciu oprogramowania Agilent CytoGenomics, wersja 3.0. Genomowe warianty liczby kopii, znane również jako straty (skreślenia) i zyski (duplikacje), analizowano za pomocą następujących bioinformatycznych baz danych: Online Mendelian Inheritance w Man, UniGene, Conserved Domain Database i BioGPS. Polimorficzne warianty liczby kopii zgłoszone w Bazie Wariacji Genomicznych14 zostały usunięte z dalszej analizy. Testowanie reakcji łańcuchowej polimerazy
Badanie reakcji łańcuchowej polimerazy (PCR) przeprowadzono z użyciem 15 ng DNA, z użyciem HiFi HotStart DNA Polymerase (Kapa Biosystems ). Usunięto każdy egzon kodujący TEX11 i co najmniej 50 par zasad intronów flankujących (w zakresie od 274 do 632 bp), w tym ekson 2 (izoforma 2) i eksony 3 do 31 (izoforma 1) (tabela S1 w dodatkowym dodatku, dostępny z pełny tekst tego artykułu na). Dalekosiężny PCR przeprowadzono przy użyciu 200 ng DNA, przy użyciu zestawu Takara LA PCR, wersja 2.1 (Clontech) i przedniego startera TCTGTCCGAAAAGTCACATATCTCTGTTTCTG i odwrotnego startera TATACAGTTGCTATGGACCGAATGTTTGTGTC. Produkty PCR były prowadzone w sekwenatorze ABI Prism 3130xl przy użyciu zestawu do sekwencjonowania cykli BigDye Terminator (wersja 3.1) (Applied Biosystems).
Dane z bezpośredniego sekwencjonowania Sangera analizowano za pomocą oprogramowania Sequencher (Gene Codes). Związek między mutacjami TEX11 a azoospermią oceniano za pomocą dokładnego testu Fishera (z wartościami P <0,05 uważanymi za wskazujące na istotność statystyczną). Ilościową reakcję PCR przeprowadzono z użyciem 20 n g DNA, przy użyciu iQ SYBR Green Supermix (Bio-Rad Laboratories). Startery stosowano wyłącznie w eksonach TEX11 od 10 do 12 i jako kontrolę stosowano beta-aktynę (ACTB) (tabela S2 w dodatkowym dodatku).
Obliczyliśmy względną liczbę kwantyfikacji za pomocą metody Ct. ? Ct dla każdej próbki obliczono jako ?Ct = CtTEX11exon-CtACTB, (z Ct oznaczającym próg cyklu i ACTB, beta-aktynę). Ct dla każdej próbki eksperymentalnej obliczono jako Ct = ?Ctexperimental-Ctcontrol. Względne oznaczenie ilościowe (RQ) obliczono jako RQ = 2 (-Ct).
Ocena ekspresji TEX11 w tkance jąder
Skrawki tkanki jąder od zdrowych i płodnych myszy, makaków (Macaca fascicularis) i ludzi barwiono pierwotnym przeciwciałem anty-TEX11 (rozcieńczenie 1: 100 kozim przeciwciałem poliklonalnym) (ab99461, Abcam) [więcej w: terapia cranio-sacralna, plastyka krocza, wagi apteczne ]

Powiązane tematy z artykułem: plastyka krocza terapia cranio-sacralna wagi apteczne

Posted by on 12 lipca 2018

Jako referencję wykorzystano męski DNA oczyszczony z próbek krwi pobranych od mężczyzn i dostarczonych przez Promega. W celu wykreślenia delecji chromosomu X zastosowano docelową mikromacierz o wysokiej rozdzielczości X-chromosom zaprojektowany w Pittsburgh Cytogenetics Laboratory (180K oligonukleotyd aCGH z użyciem platformy Agilent). Dane aCGH analizowano przy użyciu oprogramowania Agilent CytoGenomics, wersja 3.0. Genomowe warianty liczby kopii, znane również jako straty (skreślenia) i zyski (duplikacje), analizowano za pomocą następujących bioinformatycznych baz danych: Online Mendelian Inheritance w Man, UniGene, Conserved Domain Database i BioGPS. Polimorficzne warianty liczby kopii zgłoszone w Bazie Wariacji Genomicznych14 zostały usunięte z dalszej analizy. Testowanie reakcji łańcuchowej polimerazy
Badanie reakcji łańcuchowej polimerazy (PCR) przeprowadzono z użyciem 15 ng DNA, z użyciem HiFi HotStart DNA Polymerase (Kapa Biosystems ). Usunięto każdy egzon kodujący TEX11 i co najmniej 50 par zasad intronów flankujących (w zakresie od 274 do 632 bp), w tym ekson 2 (izoforma 2) i eksony 3 do 31 (izoforma 1) (tabela S1 w dodatkowym dodatku, dostępny z pełny tekst tego artykułu na). Dalekosiężny PCR przeprowadzono przy użyciu 200 ng DNA, przy użyciu zestawu Takara LA PCR, wersja 2.1 (Clontech) i przedniego startera TCTGTCCGAAAAGTCACATATCTCTGTTTCTG i odwrotnego startera TATACAGTTGCTATGGACCGAATGTTTGTGTC. Produkty PCR były prowadzone w sekwenatorze ABI Prism 3130xl przy użyciu zestawu do sekwencjonowania cykli BigDye Terminator (wersja 3.1) (Applied Biosystems).
Dane z bezpośredniego sekwencjonowania Sangera analizowano za pomocą oprogramowania Sequencher (Gene Codes). Związek między mutacjami TEX11 a azoospermią oceniano za pomocą dokładnego testu Fishera (z wartościami P <0,05 uważanymi za wskazujące na istotność statystyczną). Ilościową reakcję PCR przeprowadzono z użyciem 20 n g DNA, przy użyciu iQ SYBR Green Supermix (Bio-Rad Laboratories). Startery stosowano wyłącznie w eksonach TEX11 od 10 do 12 i jako kontrolę stosowano beta-aktynę (ACTB) (tabela S2 w dodatkowym dodatku).
Obliczyliśmy względną liczbę kwantyfikacji za pomocą metody Ct. ? Ct dla każdej próbki obliczono jako ?Ct = CtTEX11exon-CtACTB, (z Ct oznaczającym próg cyklu i ACTB, beta-aktynę). Ct dla każdej próbki eksperymentalnej obliczono jako Ct = ?Ctexperimental-Ctcontrol. Względne oznaczenie ilościowe (RQ) obliczono jako RQ = 2 (-Ct).
Ocena ekspresji TEX11 w tkance jąder
Skrawki tkanki jąder od zdrowych i płodnych myszy, makaków (Macaca fascicularis) i ludzi barwiono pierwotnym przeciwciałem anty-TEX11 (rozcieńczenie 1: 100 kozim przeciwciałem poliklonalnym) (ab99461, Abcam) [więcej w: terapia cranio-sacralna, plastyka krocza, wagi apteczne ]

Powiązane tematy z artykułem: plastyka krocza terapia cranio-sacralna wagi apteczne